Products/Services Used | Details | Operation |
---|---|---|
Peptide Synthesis | The human heavy-chain ferritin gene (Gen Bank: AAA35832.1) was amplified with polymerase chain reaction (PCR) from pUC57-Fn OPT (GenScript, NJ 08854, USA) using the forward (5′–CATATGACGACCGCGTCTACCTCTCAAGTG–3′) and reverse (5′–CCACTGAGGCTGTTACTTAGCACTGAGCTC–3′) primers. The PCR products were inserted into a pET-42b vector to produce pET-Fn plasmid, which was introduced into BL21 (DE3) competent Escherichia coli. The pUC57-Fn OPT plasmid was also used as a template to design silica-forming peptide-Fn genes by overlap extension PCR with three forward and one reverse primers as follows: F1-Kps, ACTGGTGCTAACATGACGACCGCGTCTAC; F2-Kps, TCACCATCACCATCACACTGGTGCTAACATG; F3-Kps, CATATGAAGCCGTCTCACCATCACCATCAC for Kps-Fn genes. | Get A Quote |
Biosilica materials can be generated by biomolecules under physiological or mild/ambient conditions. However, nanosized and tunable design method of biosilica particles has not yet been set up. Here, Kps, a silica forming peptide (KPSHHHHHTGAN) was introduced to N-terminus of ferritin via protein fusion method to generate new Kps-modified ferritin (Kps-Fn) for reliable formation of biosilica particles. Then, novel chimeric Kps-Fn was designed for controllable generation of biosilica nanoparticles (NPs). By changing the ratios of Kps-Fn and Fn subunits in the chimeric Kps-Fn templates, desired size of biosilica NPs (100–500 nm) can be achieved. The low surface density of Kps on the chimeric template could l... More