| Products/Services Used | Details | Operation |
|---|---|---|
| Codon Optimization | To obtain HEK 293 and COLO 357/FG derivative cell lines in which SLFN11 expression was obliterated using the CRISPR– Cas9 technique, cells were transfected with pSpCas9(BB)-2A-Puro (PX459) all-in- one CRISPR–Cas9 construct and selected based on puromycin resistance (for HEK 293 cells: SLFN11 CRISPR–Cas9 guide RNA 4, GCAGCCTGACAACCGAGAAA; for FG cells: SLFN11 CRISPR–Cas9 guide RNA 1, GGCTTGACAGAGCGATCTTC; both were obtained from GenScript).... eGFP coding sequences in which all leucine or serine residues are encoded by one distinct codon were synthesized by GenScript and cloned into pcDNA6. | Get A Quote |
Transcriptome analysis reveals a strong positive correlation between human Schlafen family member 11 (SLFN11) expression and the sensitivity of tumor cells to DNA-damaging agents (DDAs). Here, we show that SLFN11 preferentially inhibits translation of the serine/threonine kinases ATR and ATM upon DDA treatment based on distinct codon usage without disrupting early DNA damage response signaling. Type II transfer RNAs (tRNAs), which include all serine and leucine tRNAs, are cleaved in a SLFN11-dependent manner in response to DDAs. Messenger RNAs encoded by genes with high TTA (Leu) codon usage, such as ATR, display utmost susceptibility to translational suppression by SLFN11. Specific attenuation of tRNA-Leu-TAA ... More
