Products/Services Used | Details | Operation |
---|---|---|
Proteins, Expression, Isolation and Analysis | 2-R1: CCAGACACATTGGGGTCTCT TUNEL staining TUNEL staining was conducted on both whole mount zebrafish embryos and cryopreserved tissue sections at 3 dpf using TUNEL Apoptosis Detection Kit (GenScript Cat. | Get A Quote |
Mucolipidosis type IV (MLIV) is a lysosomal storage disease characterized by neurologic and ophthalmologic abnormalities. There is currently no effective treatment. MLIV is caused by mutations in MCOLN1, a lysosomal cation channel from the transient receptor potential (TRP) family. In this study, we used genome editing to knockout the two mcoln1 genes present in Danio rerio (zebrafish). Our model successfully reproduced the retinal and neuromuscular defects observed in MLIV patients, indicating that this model is suitable for studying the disease pathogenesis. Importantly, our model revealed novel insights into the origins and progression of the MLIV pathology, including the contribution of autophagos... More