| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis | PXN‐AS1‐L full‐length sequences were synthesized by GenScript (Nanjing, China) and cloned into the Hind III and BamH I sites of pcDNA3.1 plasmid (Invitrogen), named as pcDNA3.1‐PXN‐AS1‐L. The PXN‐AS1‐L full‐length sequences were also cloned into the Hind III and BamH I sites of pSPT19 plasmid (Roche, Mannheim, Germany), termed as pSPT19‐PXN‐AS1‐L. SAPCD2 coding sequences were PCR amplified using Platinum® Pfx DNA Polymerase (Invitrogen) and the primers 5′‐CCCAAGCTTTATTGTCGCCGTGGGCTGAG‐3′ (sense) and 5′‐GGAATTCATCTGGCAAGGGCGGCAGGAA‐3′ (anti‐sense). | Get A Quote |
Accumulating evidences highlight the critical roles of long noncoding RNAs (lncRNAs) in a variety of cancers. LncRNA PXN-AS1-L was previously shown to exert oncogenic roles in hepatocellular carcinoma. However， the expression， role， and molecular mechanism of PXN-AS1-L in nasopharyngeal carcinoma (NPC) malignancy remain unknown. Here， we determined that PXN-AS1-L is upregulated in NPC tissues and cell lines. Increased expression of PXN-AS1-L predicts worse prognosis of NPC patients. PXN-AS1-L overexpression promotes NPC cell proliferation， migration， and invasion in vitro， and NPC tumor growth in vivo. PXN-AS1-L silencing suppresses NPC cell proliferation， migration， and invasion in vitro. Mec... More
