Products/Services Used | Details | Operation |
---|---|---|
Catalog Antibody | siRNA specifically targeting YY1 (GACGACGACTACATTGAACAA), SET7/9 (TAGGGCCAGGGTATTATTATA) or LSD1/AOF2 (CTGGAAATGACTATGATTTAA) was purchased from Qiagen. Anti-YY1 K173me1 and anti-YY1 K411me1 antibodies were generated by GenScript, Inc. | Get A Quote |
Yin Yang 1 (YY1) is a multifunctional transcription factor shown to be critical in a variety of biological processes. Although it is regulated by multiple types of post-translational modifications (PTMs), whether YY1 is methylated, which enzyme methylates YY1, and hence the functional significance of YY1 methylation remains completely unknown. Here we reported the first methyltransferase, SET7/9 (KMT7), capable of methylating YY1 at two highly conserved lysine (K) residues, K173 and K411, located in two distinct domains, one in the central glycine-rich region and the other in the very carboxyl-terminus. Functional studies revealed that SET7/9-mediated YY1 methylation regulated YY1 DNA-binding ac... More